You may prefer our related Brainscape-certified flashcards:

Biology ATAR Flashcards

This class was created by Brainscape user Window wall window wall. Visit their profile to learn more about the creator.

Decks in this class (30)

Chapter 1: Scientific Inquiry Skills
0  cards
Chapter 2: Processes for the Continuity of Life
Mitosis and meiosis similarities,
Mitosis and meiosis differences,
What is meiosis
52  cards
Chapter 3: DNA Structure and function
Where is dna found in eukaryotes,
Where is dna found in prokaryotes,
Where else is dna found in prokar...
71  cards
Chapter 4: Variation & Mutation
When is a gene expressed,
What is the phenotype,
What is variation
50  cards
Chapter 5: Genetics
Signs a pedgree is autosomal domi...,
Signs a pedgree is autosomal domi...,
Signs a pedgree is autosomal domi...
20  cards
Chapter 6: Biotechnology - Its Tools & Techniques
Ingredients required for pcr,
What are primers,
Define buffer solution
53  cards
Chapter 7: Biotechnology in Agriculture & Environmental Conservation
How can recombinant dna technolog...,
What should conservation planning...,
What can biotechnology be used fo...
12  cards
Chapter 8: Evidence for the Theory of Evolution
Define fossil,
What is the fossil record,
What is relative dating
37  cards
Chapter 9: Mechanisms of Evolution of Speciation
What is a gene pool,
What can genes pools be used for,
Factors effecting gene pools
61  cards
Tuberculosis Flashcards
Describe how the tuberculosis pat...,
Describe the impact that the tube...,
Explain how vaccination helps to ...
14  cards
Tetanus Flashcards
Pathogen type,
Life cycle of the pathogen,
Reproductivie method of pathogen
11  cards
Crown Gall Flashcards
Is crown gall an infectious disea...,
Symtoms of crown gall,
Crown gall mode of transmission
9  cards
Chitridiomycosis Flashcards
Incubation period of chitridiomyc...,
Symptoms of chitridiomycosis,
Spread of chytridiomycosis
12  cards
Malaria Flashcards
B describe how malaria is transmi...,
Outline two distinctly different ...,
Symptoms of malaria
19  cards
Phytophthora Flashcards
Phytophthora symptoms,
Phytophthora incubation period,
Phytophthora mode of transmission
8  cards
Influenza Flashcards
Symptoms of influenza,
Incubation period for influenza,
Why cant a viral pathogen such as...
13  cards
Ross River Virus Flashcards
Symptoms of ross river virus,
Ross river virus pathogen type,
Ross river virus mode of transmis...
11  cards
Viral Diseases of Honeybees Flashcards
Cbpv symtoms,
Dwv symptoms,
Viral diseases of honeybees mode ...
10  cards
Australian Bat Lyssavirus Flashcards
Australian bat lyssasvirus symptoms,
Australian bat lyssiavirus incuba...,
Why does the ablv pathogen pose s...
13  cards
Halophytes Flashcards
What are the structural adaptatio...,
What are the physiological adapta...,
How does an aerial root system ca...
30  cards
Xerophytes Flashcards
What are the strucutral adaptatio...,
What are the physiological adapta...,
How does a thick waxy cuticle wor...
18  cards
Homeostasis Flashcards
Descrbie the difference between a...,
What is the purpose of homeostasis,
Clarify how positive and negative...
32  cards
Spread of pathogens flashcards
Life cycle of a pathogen,
What are the portals of entry,
What are mucous membranes
68  cards
Osmoregulation Flashcards
What is deamination,
How do birds deal with nh3,
How do mammals deal with nh3
89  cards
General Disease Info Flashcards
What is a disease,
When is a disease infectious,
What is a host
65  cards
Past WACE Papers Homeostasis Questions
List four different adaptations o...,
Some desrt animals do not need to...,
How can diverting blood flow to e...
70  cards
Unit 4 Chat GPT Exam Style Questions
Describe the general life cycle o...,
What sets infectious diseases apa...,
Explain the concept of a zoonotic...
71  cards
Unit 3 Chat GPT Exam Style Questions
Explain why the replication of ge...,
Describe the structure of dna and...,
How do the structural properties ...
56  cards
WACE shit
Approximately when did life first...,
List three structural properties ...,
Define the term genetic code
156  cards
WACEEEEEEEEEEEE
Describe sturcutre of codon,
Suggest why the information conta...,
3 caattgataagtcagtcaatggat 5 5 gt...
72  cards

More about
Biology ATAR Flashcards

  • Class purpose General learning

Learn faster with Brainscape on your web, iPhone, or Android device. Study Window wall window wall's Biology ATAR Flashcards flashcards now!

How studying works.

Brainscape's adaptive web mobile flashcards system will drill you on your weaknesses, using a pattern guaranteed to help you learn more in less time.

Add your own flashcards.

Either request "Edit" access from the author, or make a copy of the class to edit as your own. And you can always create a totally new class of your own too!

What's Brainscape anyway?

Brainscape is a digital flashcards platform where you can find, create, share, and study any subject on the planet.

We use an adaptive study algorithm that is proven to help you learn faster and remember longer....

Looking for something else?

AP® Biology
  • 13 decks
  • 745 flashcards
  • 51,090 learners
Decks: Evolution, Dna Rna And Protein, Cell Structure, And more!
Biology Flashcards
  • 20 decks
  • 5154 flashcards
  • 2 learners
Decks: 1 Characteristics Classification Of Livi, 2 Organisation Of The Organism, 3 Movement In Out Of Cells, And more!
Human Biology ATAR
  • 25 decks
  • 511 flashcards
  • 38 learners
Decks: Cell Structure, Structure Funtion Of The Cell, Transport Across The Cell Membrane, And more!
EMS Accelerated 2020 (Book Flashcards)
  • 44 decks
  • 1405 flashcards
  • 162 learners
Decks: Chapter 1 Ems Systems, Chapter 2 Workforce Safety And Wellness, Chapter 3 Medical Legal And Ethical Issu, And more!
Make Flashcards